GET THE APP

Identification of Helicobacter Pylori and Their Virulence Gene (cagA and vacA) in Saliva of Iraqi Adult Patients with Gastritis Using Polymerase Chain Reaction Technique

Journal of Research in Medical and Dental Science
eISSN No. 2347-2367 pISSN No. 2347-2545

All submissions of the EM system will be redirected to Online Manuscript Submission System. Authors are requested to submit articles directly to Online Manuscript Submission System of respective journal.

Review Article - (2022) Volume 10, Issue 7

Identification of Helicobacter Pylori and Their Virulence Gene (cagA and vacA) in Saliva of Iraqi Adult Patients with Gastritis Using Polymerase Chain Reaction Technique

Rawya A Mahmood* and Maha A Mahmood

*Correspondence: Rawya A Mahmood, Department of Basic Science, College of Dentistry, University of Baghdad, Iraq, Email:

Author info »

Abstract

Background: Helicobacter pylori is a Gram-negative spiral-shaped bacteria that infects up to 50% of the global population. It has been identified as one of the major risk factors for acute and chronic gastritis, peptic ulcer disease, gastric cancer, and low grade gastric mucosa associated lymphoid tissue lymphomas.

Objective: To detect the presence of Helicobacter pylori in saliva of patients with gastritis by Polymerase Chain Reaction (PCR) method.

Method: Un stimulated saliva samples were collected from 60 subjects (25 males, 35 females) attending the Gastroenterology and Hepatology Hospital in Baghdad medical city, and they diagnosed by physicians according to endoscopic findings as positive H. pylori (patient group) and negative H. pylori (control group) as they detected by specialist histopathologic during the period from December 2020 to April 2021.

PCR was used to amplify 16S rRNA genes specific for H. pylori and, the positive isolates to 16S rRNA were subjected to amplify cagA and vacA genes.

Results: of the 30 saliva samples, 16 (53.33%) sample were positive to 16S rRNA genes in patients group, while only 3/30 (10.00%) saliva samples gave positive result to 16S rRNA genes in control group. In patients, all of the samples were positive for vacA gene 16/16 (100), while 5 of 16 was positive for cagA gene (31.25%), whereas in control group, 3/3 (100%) of saliva samples were positive for the two genes.

Conclusion: Helicobacter pylori can be found in the oral cavity in addition to and independently of their presence in the stomach.

Keywords

Helicobacter pylori , Gastritis, PCR, 16S rRNA, CagA gene, VacA gene

Introduction

Gastritis is a condition in which the stomach lining becomes inflamed due to mucosal injury [1]. The most prevalent infectious etiological agent linked to gastritis is Helicobacter pylori [2]. Gastritis can also be caused by long-term use of Non-Steroidal Anti-Inflammatory Medications (NSAIDs), tobacco usage, alcohol consumption and steroids [3]. Gastritis classified into two types, either acute or chronic; after H. pylori enters the stomach, it causes acute gastritis, which is defined as a temporary mild sickness marked by nausea, vomiting, epigastric discomfort, and heartburn, these symptoms begin within the first week of infection and reach their peak severity between the 9th and 12th day of illness. After that, the symptoms improve, and after two weeks of the infection, the majority of them are gone [4]. Chronic gastritis is characterized by inflammatory cell infiltration, with lymphocytes and plasma cells predominating, as well as a large number of neutrophils [5]. Helicobacter pylori are Gram-negative spiral-shaped bacteria that affects up to half of the world's population with a higher frequency in developing nations [6]. H. pylori is a fastidious microorganism because its requires a long incubation period from 5 to 7 days under micro-aerophilic conditions and required also a selective media which contain supplement and antibiotics, so the isolation of H. pylori is consider to be difficult in a proper culture media [7]. H. pylori was identified and cultured for the first time by Barry Marshall and Robin Warren [8]. The bacteria causes’ acute and chronic gastritis in all infected individuals, as well as peptic ulcer disease, gastric cancer, and low-grade gastric Mucosa Associated Lymphoid Tissue Lymphomas (MALT) [9]. H. pylori produce a wide range of virulence factors that aid in their survival in acidic environments, motility and spatial orientation in gastric mucus, and epithelial cell adhesion [10]. The main virulence genes of Helicobacter pylori are vacuolating cytotoxin a (vacA ) and cytotoxic associated antigen a (cagA ) [11]. The cagA gene is not found in all H. pylori strains, however it has been linked to clinical outcomes such as gastritis and Peptic Ulcer Disease (PUD), as well as an increased risk of gastric cancer [12,13] The vacA gene is present in all H. pylori strains, and certain of its subtypes are linked to chronic gastric mucosal inflammation and the development of PUD [14].

 Invasive and non-invasive method can be used to diagnose H. pylori infection; invasive testing includes: histology, microbiological culture, rapid urease test, and polymerase chain reaction whereas non-invasive testing includes: urea breath test, stool antigen test, and serological test [15]. By using specific target genes, molecular technologies such as Polymerase Chain Reaction (PCR) have been developed for direct detection of H. pylori in clinical samples such as biopsy and saliva. It was recorded to offer better, more accurate results and time consuming [16,17]. PCR was utilized to detect H. pylori from a variety of clinical samples using genes such as: 16S rRNA, 23S rRNA, CagA , urea and ureC [18,19]. According to some researchers, the mouth cavity can serve as an extra-gastric reservoir for H. pylori and as a result, PCR technique was used to detect H. pylori in the saliva of individuals with and without gastritis [20,21]. One of the specific targets to confirm the presence of this pathogenic bacterium is the 16S rRNA, and positive amplification of H. pylori specific DNA may be measured as direct evidence of the pathogen's presence [22-24].

Literature Review

Patients and methods

Sixty subjects enrolled in this study, suffering from different complaints such as loss of appetite, weight loss, diarrohea, vomiting, dyspepsia, epigastric pain and others, have been taking appointment for Esophagogastroduodenoscopy (OGD) in Gastroenterology and Hepatology Hospital-Baghdad medical city in the period from December 2020 to April 2021. They diagnosed by physicians according to endoscopic findings as positive H. pylori (patient group) and negative H. pylori (control group) as they detected by specialist histopathologic. The endoscopic diagnosis was done with the assistance of the consultant physician at the Endoscopy Department. The patients group consist of 30 individuals (12 male and 18 female) with a mean of age (40.60) year, while the control group were 30 individuals (13 male and 17 female) with a mean of age (35.60) year. Unstimulated saliva samples (2 ml) were collected from each fasting subject from both study groups prior to endoscopy in early morning between 7 am to 8 am in sterile graduated containers by spit technique and preserved at -20 until analysis. Each frozen saliva specimen was thawed; genomic DNA was then extracted directly, using the pro mega extraction genomic DNA kit individually.

Polymerase Chain Reaction (PCR)

After extracting DNA from saliva specimens from patients and control subjects and using specific primers, the PCR amplification process was carried out. The primer sequence for amplification of the 16S rRNA gene was as follows:

16S rRNA, F (5’-TTGGAGGGCTTAGTCTCT-3’) R (5'-AAGATTGGCTCCACTTCACA-3’) with product size 310 bp [25]. Primers were used by making working solution, 10 μl from the stock solution plus 90 μl dd H2O to obtain 100 μl working solution.

PCR working solution: Preparation of the reaction mixture on ice for amplification of 16S rRNA gene was done for a 25 μl reaction volume, as in Table 1.

Component Volume (μl)
One Taq (NEB®) master mix 12.5 μl
DNA sample 5 μl
Forward primer 1.5 μl
Reverse primer 1.5 μl
Nuclease-free water 4.5 μl
Final volume 25 μl

Table 1: Components of PCR reaction mixture for amplification of 16S rRNA H. pylori . º

The thermal cycle (Eppendorf, Germany) was used in conjunction with a thermal profile. The PCR process consists of thirty two cycles, each cycle involves three steps: initial denaturation at 94ºC for 5 minutes, denaturation at 94ºC for 30 sec, annealing at 55ºC for 45 sec, extension at 72ºC for 30 sec, and a final extension step at 72ºC for 7 minutes. By using agarose gel electrophoresis, the PCR products were identified by their size. The size of the PCR products was determined by comparing them to a DNA ladder (NEB®, 1000 bp DNA, England) that contains DNA fragments of known size.

Detection of h. pylori -virulence factors’ (vacA and cagA genes)

In general, all samples positive for the polymerase chain reaction were submitted for detection of vacA , cagA genes. Detection of these virulence genes was carried out by using PCR and using specific primer. The primer sequence for amplification of the vacA gene was: F (5’-ATGGAAATACAACAAACACAC-3’) R (5’CCTGAGACCGTTCCTACAGC-3’) with product size 107 bp, and primer sequence of the cagA gene was:

F(5’-AAGAAAGGCAAGAAGCAGAAAA-3’) R(5’- ACACAGAAGACAGAGCGTTATT -3’) with product size 294 bp [27]. The Primers were used by making working solution, 10 μl from the stock solution plus 90 μl dd H2O to obtain 100 μl working solution [26]. All amplification reactions were carried out in total volumes of 25 μl, as shown in (Table 2).

Component

Volume (μl)

OneTaq (NEB®) mastermix

12.5 μl

DNA sample

5 μl

Forward Primer

1.5 μl

Reverse Primer

1.5 μl

Nuclease-Free Water

4.5 μl

Final Volume

25 μl

Table 2: Components of PCR reaction mixture for amplification of vagA and cagA genes.

The PCR thermo cycler conditions were established as thirty two cycle, each cycle involves three steps: initial denaturation at 94oC for 5 minutes, denaturation at 94ºC for 30 sec, annealing at 47ºC for 45 sec for vacA gene, while in cagA gene the annealing temperature was at 52ºC for 45 sec, extension at 72ºC for 30 sec, and a final extension step at 72ºC for 7 minutes. By using agarose gel electrophoresis, the PCR products were identified by their size. The size of the PCR products was determined by comparing them to a DNA ladder (NEB®, 1000 bp DNA, England) that contains DNA fragments of known size.

Statistical analysis: Statistical analysis was carried out using the Statistical Package for Social Science version 21 (SPSS), (Chicago, Illinois, USA).

Detection of H. pylori DNA in saliva specimens by PCR in study groups

The use of saliva by some researchers in previous studies to detect the presence of H. pylori encourages us to understand the role of saliva in diagnosis of H. pylori infection as an easy and comfortable method for patients instead of endoscopy, which is painful for them. The results of this study revealed that 16 (53.33%) of saliva specimens from patients complaining of severe gastritis detected positive for 16S rRNA, while only 3(10%) of individuals in the control group detected positive for 16S rRNA, a shown in (Figure 1).

medical-dental-science

Figure 1: Detection of the PCR product DNA bands of Helicobacter pylori 16S rRNA gene (310 bp) in study groups. The amplified fragments were separated by electrophoresis on a 2% agarose gel, stained with Red Safe dye at 80 volts/cm for 1 hour. DNA ladder (100 bp step). A: patients group. Lane L DNA ladder (100 bp). Lanes 14,16,17,29,33,36 shows PCR product positive to 16S rRNA gene, while Lanes 1,3,6,7,11 shows negative to 16S rRNA gene. B: control group Lane L DNA ladder (100 bp). Lanes 20 shows PCR product positive to 16S rRNA gene, while Lanes 5,10,12, 21, 23, 24, 25, 26, 31 shows negative to 16S rRNA gene.

In a closely related study, Silva and her colleagues discovered H. pylori DNA in 16 of 30 saliva samples, suggesting that saliva samples may act as a temporary reservoir for H. pylori [28]. Whereas Nagata used nested PCR to detect H. pylori in saliva samples at percentage (4.5%) of eighty-eight subjects [29].

The present study is agree with the local study by Al Thwani and Ali in 2013 who stated that they cannot be rely on saliva samples for the detection of H. pylori infection due to the low percentage of positive results they have obtained during her research, which represented (9.4%) using PCR technique [30]. In contrast, Goud revealed a successful amplification and detection of H. pylori directly from saliva samples using 16S rRNA gene by PCR in the majority of patients with gastritis in percentage of 80%, also they showed that 30% of cases indicating H. pylori in the saliva of 50% of patients who showed negative result of H. pylori in endoscopic gastric biopsy, so this may be due to the ability of these organisms to survive in the oral cavity with low numbers for a long period without colonizing the stomach or gastric walls [31].

Some researchers found no link between H. pylori in the oral cavity and H. pylori in the stomach, thus saliva samples cannot be utilized as a primary diagnostic test for H. pylori gastric infection [32]. Myriam and her colleagues used 30 saliva samples in their research, and none of the them yielded a positive PCR result, while Ahmed and his colleagues believe that the oral cavity may be a reservoir of H. pylori infection, and that oral secretion could be an essential mode of H. pylori transmission [33,34].

Identification of vacA and cagA genes of H. pylori in saliva samples

The current data revealed that the overall prevalence of the vacA gene was detected in all isolated samples of the patients 16/16 (100%), and the same results for the control group, which detected in all isolated samples 3/3 (100%) whereas the results for the cagA gene was found in only 5 saliva samples out of the 16 isolated samples of the patients, at a percentage of (31.25%), and 3/3 (100%) of cases in control group, as shown in (Figure 2).

medical-dental-science

Figure 2: A) Detection of the PCR product DNA bands of Helicobacter pylori vacA gene (107bp). The amplified fragments were separated by electrophoresis on a 2% agarose gel, stained with Red Safe dye at 80 volts/cm for 1 hour. DNA ladder (25 bp). Lane L DNA ladder (107 bp). Lanes 14,16,17,29,33,36 shows PCR product positive to vacA gene(positive H. pylori group), while Lane 20 shows PCR product positive to vacA gene (negativ H. pylori group). B) Detection of the PCR product DNA bands of Helicobacter pylori cagA gene (294 bp). The amplified fragments were separated by electrophoresis on a 2% agarose gel, stained with Red Safe dye at 80 volts/cm for 1 hour. DNA ladder (25 bp). Lane L DNA ladder (294 bp). Lanes 17,29 shows PCR product positive to cagA gene (positive H. pylori group), while Lane 20 shows PCR product positive to cagA gene (negative H. pylori group).

Results and Discussion

A comparison of the present results related to vacA and cagA gene was fluctuated with results of other studies of neighbouring countries patients, as in Jordan, Abu-Lubada and colleagues, who identified these genes from dental plaque in the oral cavity using PCR, where the cagA gene was found in 14 out of 60 samples (23.3%), while vacA gene was found in all individuals participating in this research (100%). Another research by Rasmussen and his team, who claimed that they found cagA gene in saliva sample by 13/26 (50%) and vacA gene by 26/26 (100%) and in the same year Momtaz detected the both genes at a ratio 100% in saliva samples [35-37].

Roman-Roman and colleagues discovered vacA allelic variants in 78.3% (47/60) of patients with saliva H. pylori positive, implying that gastric infection is not the only cause of H. pylori in the oral cavity, and that the bacterium could enter the mouth through other routes besides gastric reflux [38].

Miyabayashi conducted one of the earliest studies on the effect of oral H. pylori on stomach infection [39]. Their research discovered a link between gastritis caused by H. pylori infection and oral colonization of the bacteria, as well as those oral H. pylori is resistant to the standard triple anti H. pylori treatment used to remove it from the stomach. As a result, individuals with oral H. pylori had a substantially higher risk of stomach reinfection after effective treatment [40]. Many epidemiological variables, such as eating habits, oral hygiene, and illness history, were shown to influence H. pylori infection in the mouth [41]. Furthermore, the oral cavity has been proposed as a temporary or permanent H. pylori infection site.

This study showed 10% of salivary H. pylori positive cases within the individuals with gastric symptoms who showed negative status of H. pylori in histopathology biopsy may be due to production of biofilm matrix by H. pylori, which may cause embedding of H. pylori in their matrix that may would have interfered with staining of organisms leading to false negativity.

Conclusion

The presence of H. pylori in saliva samples of gastric H. pylori negative (independent, although in small numbers), and the low isolation rate (53.33%) of this bacteria from saliva of positive H. pylori gastritis patients showed a lack of connection between oral and gastric bacterial colonization. As a result, H. pylori may be detected in the oral cavity in the absence of a stomach infection.

References

Author Info

Rawya A Mahmood* and Maha A Mahmood

Department of Basic Science, College of Dentistry, University of Baghdad, Iraq
 

Citation: Rawya A Mahmood, Maha A Mahmood, Identification of Helicobacter pylori and their virulence gene (cagA and vacA ) in Saliva of Iraqi Adult Patients with Gastritis Using Polymerase Chain Reaction Technique, J Res Med Dent Sci, 2022, 10 (7): 059-068.

Received: 28-Apr-2022, Manuscript No. JRMDS-22-P-47764; , Pre QC No. JRMDS-22-P-47764; Editor assigned: 30-Apr-2022, Pre QC No. JRMDS-22-P-47764; Reviewed: 14-May-2022, QC No. JRMDS-22-P-47764; Revised: 28-Jun-2022, Manuscript No. JRMDS-22-P-47764; Published: 05-Jul-2022

cappadocia tours
cappadocia hotels
cappadocia balloon flights

paper.io

agar io

wormax io